Skip to main content

Table 1 Primers used for quantitative real-time PCR analysis

From: A long-term anti-inflammation markedly alleviated high-fat diet-induced obesity by repeated administrations of overexpressing IL10 human umbilical cord-derived mesenchymal stromal cells

Primer name Species Sequence forward (5'to3') Sequence reverse (5'to3')
IL10 Mouse GCTGAGGCGCTGTCATCGATTT GGCCCTGCAGCTCTCAAGTGT
IL6 Mouse TCAATTCCAGAAACCGCTATGA CACCAGCATCAGTCCCAAGA
IL1β Mouse CGTGCTGTCGGACCCATATGAG GCCCAAGGCCACAGGTATTT
IL4 Mouse TCACTGACGGCACAGAGCTA CTGTGGTGTTCTTCGTTGCTG
TNFα Mouse ACGTCGTAGCAAACCACCAA ACCCTGAGCCATAATCCCCT
PPARγ Mouse TCGCTGATGCACTGCCTATG GAGAGGTCCACAGAGCTGATT
C/EBPα Mouse CAAGAACAGCAACGAGTACCG GTCACTGGTCAACTCCAGCAC
SREBP-1c Mouse GAGCGAGCGTTGAACTGTAT ATGCTGGAGCTGACAGAGAA
Adiponectin Mouse TGTTCCTCTTAATCCTGCCCA CCAACCTGCACAAGTTCCCTT
GAPDH Mouse ACAACTTTGGCATTGTGGAAG GTTGAAGTCGCAGGAGACAAC