Skip to main content

Table 1 Primers for the qRT-PCR and probes used in cell transfection

From: A novel hypoxic lncRNA, HRL-SC, promotes the proliferation and migration of human dental pulp stem cells through the PI3K/AKT signaling pathway

Gene name sense (5′–3′) Anti-sense(5′–3′)
β-actin TCACCATGGATGATGATATCGC ATAGGAATCCTTCTGACCCATGC
MSTRG.20649.1 TGGAGGGAAGACACTGTCCTAT TGCTTGGTGGGGGTTATCCA
MSTRG.8144.1 GGATTGTTCCCCACAAACCA ATTCCAGTAACCTGCCCTTGG
MSTRG.27918.3 TCAAAGTGGGTCAGTGCAGG CCTCAGGCCAACAGAGTAGC
MSTRG.31275.1 TCTCACATCCAATTCCCCGT GAGTGCCACCTAGTGCTACC
MSTRG.16037.1 GAAAAGGGGTGTCAGCAACAA TCACACAGACATCACTCCGTC
MSTRG.6909.1 AGCTGCAAAAGGCATCCTAGT CCCCACAGCGTTTAATGGAAG
MSTRG.11228.1 TCGGGTGATGATGGTTCCAC GAACCACCTCCCGAACCCAA
MSTRG.10485.1 CGGTGGCTCACTCATTGACA TGGACTTGGTCTGTTAAGGGC
MSTRG.15583.1 TGCCACATCGTGTGTTCTGT AGACACGGTAACCACACACC
MSTRG.11101.4 CAGACGCTCCCCGCAGA ATCAAGACACCTGCCTTCCA
PDK1 CTGTGATACGGATCAGAAACCG TCCACCAAACAATAAAGAGTGCT
siRNA1 CCACAAAUGGCCUGAACUGUATT UACAGUUCAGGCCAUUUGUGGTT
siRNA2 CCUCAGGUAGCUGCUGUUUGUTT ACAAACAGCAGCUACCUGAGGTT
siRNA3 UGCUGUUUGUGUGAGAAAGAATT UUCUUUCUCACACAAACAGCATT