Skip to main content

Table 1 Primer sequences

From: lncRNA SNHG1 regulates odontogenic differentiation of human dental pulp stem cells via miR-328-3p/Wnt/β-catenin pathway

Genes Primes Sequences (5′–3′)
GAPDH Forward GGAGCGAGATCCCTCCAAAAT
  Reverse GGCTGTTGTCATACTTCTCATGG
SNHG1 Forward GGAACAGACACGAAGTGGA
  Reverse AGAACCCAAACTCAGGCA
ALP Forward GAGATGTTGTCCTGACACTTGTG
  Reverse AGGCTTCCTCCTTGTTGGGT
DMP-1 Forward AGGAAGTCTCGCATCTCAGAG
  Reverse TGGAGTTGCTGTTTTCTGTAGAG
DSPP Forward ATATTGAGGGCTGGAATGGGGA
  Reverse TTTGTGGCTCCAGCATTGTCA
U6 Forward CTCGCTTCGGCAGCACA
  Reverse AACGCTTCACGAATTTGCGT
miR-328-3p Forward GCTGGCCCTCTCTGCCC
  Reverse AGTGCAGGGTCCGAGGTATT
Axin1 Forward GACCTGGGGTATGAGCCTGA
  Reverse GGCTTATCCCATCTTGGTCATC