Skip to main content

Table 3 The sequences of siRNA and shRNA

From: Mesenchymal stem cells-derived small extracellular vesicles alleviate diabetic retinopathy by delivering NEDD4

Target Sequence (5’-3’)
PTEN siRNA CCACCACAGCUAGAACUUATT
SiRNA NC TTCTCCGAACGTGTCACGT
NEDD4 shRNA CCGGGCTGAACTATACGGTTCAAATCTCGAGATTTGAACCGTATAGTTCAGCTTTTTG
Control shRNA CCGGGCAAGCTGACCCTGAAGTTCATCTCGAGATGAACTTCAGGGTCACGTTGCTTTTTG