Skip to main content

Table 1. Primers of specific genes used in qRT-PCR analyses

From: Human umbilical cord blood-derived MSCs trans-differentiate into endometrial cells and regulate Th17/Treg balance through NF-κB signaling in rabbit intrauterine adhesions endometrium

Gene Sequence (5′–3′)
NFKB1  
 Forward CCTGAGTCTTTTGGACCGCT
 Reverse GCAGGCTATTGCTCAACACG
GAPDH  
 Forward CTTTGGTATCGTGGAAGGA
 Reverse AGGGATGATGTTCTGGAGAG