Skip to main content

Table 1 Sequences of gene-specific primers used in the present study

From: Metformin combats high glucose-induced damage to the osteogenic differentiation of human periodontal ligament stem cells via inhibition of the NPR3-mediated MAPK pathway

Gene ID Genes Forward sequence Reverse sequence
632 OCN CCCAGGCGCTACCTGTATCAA GGTCAGCCAACTCGTCACAGTC
860 RUNX2 TGGTTACTGTCATGGCGGGTA TCTCAGATCGTTGAACCTTGCTA
249 ALP AACATCAGGGACATTGACGTG GTATCTCGGTTTGAAGCTCTTCC
2597 GAPDH GGAGTCCACTGGCGTCTTCA GTCATGAGTCCTTCCACGATACC
60 β-Actin CTGCTCATCCCACTAATGTC CTTTATTAACTACCACCTGGTCCT
650 BMP2 ACCCGCTGTCTTCTAGCGT TTTCAGGCCGAACATGCTGAG
4880 CNP CTGACCGACCGACTCCAG AAATCTCTCACCTCCGCCAG
374 AREG GTGGTGCTGTCGCTCTTGATA CCCCAGAAAATGGTTCACGCT
3488 IGFBP5 ACCTGAGATGAGACAGGAGTC GTAGAATCCTTTGCGGTCACAA
8111 GPR68 TGTACCATCGACCATACCATCC GGTAGCCGAAGTAGAGGGACA
6423 SFRP2 CTTAGAGGACAGCGGGGAAG TCCAAGCATCTTGCCCTGAG
4883 NPR3 AGACTACGCCTTCTTCAACATTG GCTTCAAAGTCGTGTTTGTCTCC