Skip to main content

Table 3 Polymerase chain reaction primers used to investigate osteoblastic cell differentiation

From: A new platelet cryoprecipitate glue promoting bone formation after ectopic mesenchymal stromal cell-loaded biomaterial implantation in nude mice

Gene Identification Forward primer Reverse primer
Alkaline phosphatase NM_000478 GGCCCTACAATGCTCATGTC TGGTGGTCTTGGAGTGAGTG
Collagen type I, alpha 1 NM_000088 GAATGGAGATGATGGGGAAG CCATCCAAACCACTGAAACC
Osteocalcin (Bglap) NM_199173 GACTGTGACGAGTTGGCTGA GCAAGGGGAAGAGGAAAGAA
Osteonectin (Sparc) NM_003118 GGGCTTCTCCTCCTCTGTCT AACCGATTCACCAACTCCAC
Osteopontin (Spp1) NM_001040058 GCCGAGGTGATAGTGTGGTT CATTCAACTCCTCGCTTTCC
Runx 2 NM_001024630 GCACTGGGTCATGTGTTTGA GGCTGCATTGAAAAGACTGC
β-Actin NM_001101 TCGTGCGTGACATTAAGGAG AGGAAGGAAGGCTGGAAGAG
β-2-microglobulin NM_004048 TGTCTTTCAGCAAGGACTGG CCTCCATGATGCTGCTTACA
Gapdh NM_002046 CCAGGTGGTCTCCTCTGACT GGTGGTCCAGGGGTCTTACT
Hprt1 NM_000194 GACCAGTCAACAGGGGACAT CTTGCGACCTTGACCATCTT
  1. Gapdh, glyceraldehyde-3-phosphate dehydrogenase; hprt1, hypoxanthine phosphoribosyltransferase 1.