Skip to main content

Table 1 Primers used in this study

From: Adipose-derived stem cells improved mouse ovary function after chemotherapy-induced ovary failure

Gene GB.accession   Primer sequence 5′ → 3′ Amplicon size (bp)
GAPDH   F GTTGTCTCCTGCGACTTCA  
   R TGGTCCAGGGTTTCTTACTC 182
Cxcr4 NM_009911.3 F TCAAGCAAGGATGTGACTTCG  
   R GGCATAGAGGATGGGGTTCA 101
Onecut2 NM_194268.2 F AGAGGGTTCTATGCCGGTCT  
   R CTTTGCGTTTGCATGCTGCC 171
Bpil3 NM_199303.2 F AGCACCCGAAGTCACTCTTC  
   R AGTTAACTCCGCCTCGTGGA 161
Angpt1 NM_009640.3 F TGCTAACAGGAGGTTGGTGG  
   R GGCCCTTTGAAGTAGTGCCA 121
Zcchc11 NM_175472.3 F CAGCCCAAACCCTTCTATGC  
   R CGGATACCCTTGAGACAGCAG 143