Skip to main content

Table 1 qRT-PCR primer sequences

From: Synergistic effect of Indian hedgehog and bone morphogenetic protein-2 gene transfer to increase the osteogenic potential of human mesenchymal stem cells

Gene Sequence (5′-3′; F, forward;, R, reverse) Product (bp)
ALP F – GTACGAGCTGAACAGGAACAACG 151
R – CTTGGCTTTTCCTTCATGGTG
OP F – TATGATGGCCGAGGTGATAG 133
R – CATTCAACTCCTCGCTTTCC
OC F – TGACCACATCGGCTTTCAG 126
R – AAGGGGAAGAGGAAAGAAGG
Runx2 F – CTTCACAAATCCTCCCCAAG 147
R – ATGCGCCCTAAATCACTGAG
RPS27A F – TCGTGGTGGTGCTAAGAAAA 141
R – TCTCGACGAAGGCGACTAAT