Skip to main content

Table 1 Primer sequences used for qRT-PCR

From: Pleiotropic effects of cancer cells’ secreted factors on human stromal (mesenchymal) stem cells

No. Name Sequence
1 CCL3  
  F 5’ AAGGACACGGGCAGCAGACA 3’
  R 5’ AGCAGCAAGTGATGCAGAGAACTGG 3’
2 CCL5  
  F 5’ TACATTGCCCGCCCACTGCC 3’
  R 5’ TCGGGTGACAAAGACGACTGCT 3’
3 CCL8  
  F 5’ GGGACTTGCTCAGCCAGATTCAGT 3’
  R 5’ CAGCACAGACCTCCTTGCCCC 3’
4 CXCL2  
  F 5’ GGGGTTCGCCGTTCTCGGA 3’
  R 5’ TGCGAGGAGGAGAGCTGGCAA 3’
5 CXCL3  
  F 5’ CGCCCAAACCGAAGTCATAGCCA 3’
  R 5’ TGGTAAGGGCAGGGACCACCC 3’
6 CXCL5  
  F 5’ GTTGAGAGAGCTGCGTTGCGT 3’
  R 5’ TCAGGGAGGCTACCACTTCCACC 3’
7 CXCL6  
  F 5’ GGTAAACTGCAGGTGTTCCCCGC 3’
  R 5’ CCCGTTCTTCAGGGAGGCTACCA 3’
8 IL6  
  F 5’ CGAGCCCACCGGGAACGAAA 3’
  R 5’ GGACCGAAGGCGCTTGTGGAG 3’
9 IL1B  
  F 5’ AGGCACAAGGCACAACAGGCT 3’
  R 5’ TGGCTGCTTCAGACACTTGAGCAAT 3’
10 IGF2  
  F 5’ GCTCTGCCCCGTCGCACATT 3’
  R 5’ TTGGTGTCTGGAAGCCGGCGA 3’
11 EHF  
  F 5’ GGCATGGGGTTGCCGGAGAG 3’
  R 5’ CTGGAAACATTGCACGTGGAGTAGC 3’
12 CSF2  
  F 5’ GACCTCCAGGAGCCGACCTGC 3’
  R 5’ AGTTTCCGGGGTTGGAGGGCA 3’
13 SAA1  
  F 5’ GGCTTTTGATGGGGCTCGGGA 3’
  R 5’ CCCCCAGGTCCCCTTTTGGC 3’
14 MMP12  
  F 5’ TGCCCGTGGAGCTCATGGAGAC 3’
    R 5’ TGTGCATCCCCTCCAATGCCAG 3’