Skip to main content

Advertisement

Table 2 Primer pairs used for quantitative real-time polymerase chain reaction

From: MicroRNA-20b and ERK1/2 pathway independently regulate the expression of tissue factor in hematopoietic and trophoblastic differentiation of human embryonic stem cells

Gene symbol Forward primer (5′ to 3′) Reverse primer (5′ to 3′)
PU.1 CCTGTATGTAGCGCAAGAGATTTA CCAGCACAAGTTCCTGATTTTATC
CDX2 AGGGGGTGGTTATTGGACTC CATTCAGCCCAGAGAAGCTC
TF GCCAGGAGAAAGGGGAAT CAGTGCAATATAGCATTTG
GAPDH ACAGTCAGCCGCATCTTCTT ACGACCAAATCCGTTGACTC