Skip to main content

Table 1 Oligonucleotide sequences used for RT-PCR analysis

From: Molecular characterization and in vitro differentiation of feline progenitor-like amniotic epithelial cells

  Gene Primers Product size
Housekeeping gene GAPDH Forward, 5′ – ACGATGACATCAAGAAGGTG – 3′ 180 bp
Reverse, 5′ – CATACCAGGAAATGAGCTTG – 3′
Pluripotent markers Oct4 Forward, 5′ – GGAGTCCCAGGACATCAAAG – 3′ 285 bp
Reverse, 5′ – GCCTGCACAAGTGTCTCTGC – 3′
Nanog Forward, 5′ – ACGGATCCAGCTCAGCCCCA – 3′ 192 bp
Reverse, 5′ – GGGGCTGCCCTGAGCAAGTA – 3′
Mesenchymal markers CD44 Forward, 5′ – TGGGTTGTTTGGCATCCAGTGC – 3′ 100 bp
Reverse, 5′ – CGTTTTCTTCAGTTGGTTCCCAGCC – 3′
CD166 Forward, 5′ – ACTGGCAGTGGAAGCGTCAT – 3′ 275 bp
Reverse, 5′ – CAGCAAGGAGGAGACCA – 3′
CD29 Forward, 5′ – GGAAACTTGGTGGCATTGTT – 3′ 180 bp
Reverse, 5′ – GTTCCTTGTAAACGGGCTGA – 3′
CD73 Forward, 5′ – AGCAAAGGGGCCACTAGCATCT – 3′ 233 bp
Reverse, 5′ – ACCCGAATGTCCCAGTGCAA – 3′
CD90 Forward, 5′ – GAGCACACGTACCGCTCCCG – 3′ 233 bp
Reverse, 5′ – AGCAGCAGCAGCAGCATCCA – 3′
Hematopoietic marker CD34 Forward, 5′ – CTTTAACTGTCACGGCGTTT – 3′ 198 bp
Reverse, 5′ – TGACTCGGGAACATTTGATT – 3′
Immunological markers MHC-I Forward, 5′ – CATCACCCTGAGATGGGAGC – 3′ 176 bp
Reverse, 5′ – TGGGTACTGTCGTCGCGTG – 3′
MHC-II Forward, 5′ – TCCGGAATCAGAAAGGACAC – 3′ 172 bp
Reverse, 5′ – GGCAAACCAAATCCTGAGAA – 3′
Osteogenic markers OCN Forward, 5′ – CTGCCTCTGCCTGGCTGGTC – 3′ 120 bp
Reverse,5′ – TAGCGCCGGAGCCTCCTCAC – 3′
OPN Forward, 5′ – ACTGGTCACTGATTTTCCCACGGA – 3′ 100 bp
Reverse, 5′– AACCACACTATCACCTCGGCCA – 3′
Adipogenic markers ADPQ Forward, 5′ – TGAGAAAGGAGATCCAGGTC – 3′ 308 bp
Reverse, 5′ – TCAAGTAGACTGTGATGTGG – 3′
PPAR-γ Forward, 5′ – CATGGTTGACACAGAGATGC – 3′ 239 bp
Reverse, 5′ – GCTCCACTTTGATTGCACTTTG –3′
Chondrogenic markers ACAN Forward, 5′ – AAGTGGAGCCGCGTTTCCAAGG – 3′ 163 bp
Reverse, 5′ – AGTCATTGGAGCGCAGGTTCTGG – 3′
COL2A1 Forward, 5′ – AGTTGGGAGTAATGCAAG – 3′ 294 bp
Reverse, 5′ – GATAACCTCTGTGACCTTTG – 3′
Neurogenic marker NES Forward, 5′ – AAACAGGGCCTACAGAG – 3′ 293 bp
   Reverse, 5′ – ACAGGTGTCTCAAGGGTAG – 3′