Skip to main content

Advertisement

Table 2 Primer sequences used for the real-time polymerase chain reaction studies

From: Characterization and profiling of immunomodulatory genes of equine mesenchymal stromal cells from non-invasive sources

  Gene Name Primer sequence 5′ → 3′ Amplicon size, bp Ta, °C Efficiency, % Correlation
Reference genes ACTB Beta actin CCAGCACGATGAAGATCAAG 88 60 98 0.998
GTGGACAATGAGGCCAGAAT
GAPDH Glyceraldehyde-3-phosphate dehydrogenase CAGAACATCATCCCTGCTTC 187 59 100 0.998
ATGCCTGCTTCACCACCTTC
H2A Histone H2A type 1-C ATATTCAGGCCGTGCTGCT 105 60 100 0.999
TTTGGGTTTCAAAGCGTTTC
HPRT1 Hypoxanthine phosphoribosyl-transferase 1 GGCAAAACAATGCAAACCTT 163 57 100 0.994
CAAGGGCATATCCTACGACAA
SDHA Succinate dehydrogenase complex, subunit A TCCATCGCATAAGAGCAAAG 159 59 99 0.997
GGTGGAACTGAACGAACTCC
RPL32 Ribosomal protein L32 AGCCATCTACTCGGCGTCA 149 60 100 0.995
TCCAATGCCTCTGGGTTTC
UBC Ubiquitin C GCAAGACCATCACCCTGGA 206 60 97 0.996
CTAACAGCCACCCCTGAGAC
TUBA4A Tubulin, alpha 4a GCCCTACAACTCCATCCTGA 78 60 100 0.999
ATGGCTTCATTGTCCACCA
Test genes CD40 Cluster of differentiation 40 CAGGAAAGAAACTGGTGAATG 180 62 106 0.993
AAGTGGCGTCTGTTGTTGAG
CD80 Cluster of differentiation 80 CACCTTCACCGACATCACC 106 62-64 102 0.995
AGACCCCCTTTCGCTCTTC
CD86 Cluster of differentiation 86 AGTATAAAGGCCGCACAAGC CCTTGGGTAGATGAGCAGGT 247 63 95 0.990
HGF Hepatocyte growth factor TGCATTCAAGGTCAAGGAGA TTTTGGAATTTGGGAGCAGT 234 63 84 0.983
IDO Indoleamine 2,3-dioxygenase ACAACATCAGGACCAGGACAC TCCAGACGCCTTCATAGAG 198 61-64 72 0.957
TGFβ Transforming growth factor-β GGAATGGCTGTCCTTTGATG CGGAGTGTGTTATCTTTGCTGTC 120 61-64 92 0.997
TNFα Tumor necrosis factor-α GCCTCAGCCTCTTCTCCTTC GGCTTGTCACTTGGGGTTC 172 62-64 113 0.999
  1. Ta, annealing temperature.