Skip to main content

Table 1 Sequence of the primers used in the study

From: Myocardial transfection of hypoxia-inducible factor-1α and co-transplantation of mesenchymal stem cells enhance cardiac repair in rats with experimental myocardial infarction

Gene symbol Primer sequence Product size (base pair)
HIF-1α Sense: 5′- ATGTGACCATGAGGAAATGAGAGAA-3′ 186
  Antisense: 5′- ACGTGAATGTGGCCTGTGCA -3′  
VEGF Sense: 5′-TGCACCCACGACAGAAGGGGA-3′ 364
  Antisense: 5′-TCACCGCCTTGGCTTGTCACAT-3′  
SDF-1α Sense: 5′-AGATGCCCCTGCCGATTCTTTG-3′ 118
  Antisense: 5′-TGTTGTTGCTTTTCAGCCTTGC-3′  
β-actin Sense: 5′-TCAGGTCATCACTATCGGCAAT-3′ 432
Antisense: 5′-AAAGAAAGGGTGTAAAACGCA-3′
SRY Sense: 5′-TCTGCTCCTACCTATGCCAACA-3′ 22
  Antisense: 5′-GAGGGAACTCAGTATCCAAACCA-3′