Skip to main content

Table 1 Primer sequences for PCR analyses

From: Thrombin promotes fibronectin secretion by bone marrow mesenchymal stem cells via the protease-activated receptor mediated signalling pathways

Gene GB. accession   Primer sequence (5′-3′) Product size (bp)
FN1 NM_212478.1 Forward CCCCTGGGGTCACCTATTAC 189
   Reverse CGGTCAGTCGGTATCCTGTT  
ACTB NM_001101.3 Forward TGATGATATCGCCGCGCTCGT 168
   Reverse GCCTCGTCGCCCACATAGGAAT  
PAR1 NM_001992.3 Forward GCCTCCCACTAAACATCATGGC 199
   Reverse AATGCTGCAGTGACGAAGCG  
PAR2 NM_005242.4 Forward TGTCGTGAAGCAGACCATCTT 167
   Reverse TCATCAGCACATAGGCAGAGG  
PAR3 NM_004101.3 Forward CTGCTTCTGTTGCCCACTTT 162
   Reverse AGTAATCGTGGCTCCTGTCC  
PAR4 NM_003950.2 Forward ATGACAGTGACACCCTGGAG 188
   Reverse GAGGTTCATCAGCAGCATGG