Skip to main content

Table 1 The primers used for qPCR assays

From: Mesenchymal stem cells with overexpression of midkine enhance cell survival and attenuate cardiac dysfunction in a rat model of myocardial infarction

Genes Forward Reverse cDNA size (bp)
VEGF CAGCTATTGCCGTCCAATTGA CCAGGGCTTCATCATTGCA 131
FGF2 GGCTCTACTGCAAGAACGGC GAAACAGTATGGCCTTCTGTC 353
FGF7 TTTGGAAAGAGCGACGACTT GGCAGGATCCGTGTCAGTAT 209
TGF-β TACAGGGCTTTCGCTTCAGT TGGTTGTAGAGGGCAAGGAC 238
SDF-1a TTTCACTCTCCGTCCACCTC ATCTGAAGGGCACAGTTTGG 251
SCF TTCGCTTGTAATTGGCTTTGC TTCAACTGCCCTTGTAAGACTTGA 296
IGF-1 AAGCCTACAAAGTCAGCTCG GGTCTTGTTTCCTGCACTTC 166
GM-CSF GCTCACCCAACCCTGTCACCCG CCTCATTTCTGGACCGGCTTCC 376
β-actin AGGGAAATCGTGCGTGACAT AACCGCTCATTGCCGATAGT7 149