Skip to main content

Advertisement

Table 2 List of primers used for RT-PCR analysis

From: Are serum-free and xeno-free culture conditions ideal for large scale clinical grade expansion of Wharton’s jelly derived mesenchymal stem cells? A comparative study

Markers Forward primer Reverse primer Tm Product length
β-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT 60 250 bp
P21 GAGGCCGGGATGAGTTGGGAGGAG CAGCCGGCGTTTGGAGTGGTAGAA 63 220 bp
P53 TAACAGTTCCTGCATGGGCGGC AGGACAGGCACAAACACGCACC 60 121 bp
P16 TTATTTGAGCTTTGGTTCTG CCGGCTTTCGTAGTTTTCAT 51 354 bp
XRCC4 AAGATGTCTCATTCAGACTTG CCGCTTATAAAGATCAGTCTC 54 233 bp
PTN GGAGCTGAGTGCAAGCAAAC GAGGTTTGGGCTTGGTCAGT 59 274 bp
MCM3 TCGAGGTAACCTTTGGTGGC TGTTCAGAAGCCTCGTCGTC 55 232 bp
CDKN2B CCCAACTCCACCAGATAGCA GGGATTTCCGCATCCTAGCA 57 198 bp
ERCC3 CCAGGAAGCGGCACTATGAGG GGTCGTCCTTCAGCGGCATTT 61 171 bp
Cmyc AAGACTCCAGCGCCTTCTCTC GTTTTCCAACTCCGGGATCTG 62 526 bp
VEGF-A GCAGAATCATCACGAAGTGG GCATGGTGATGTTGGACTCC 60 234 bp
TGF-β CAGATCCTGTCCAAGCTG TCGGAGCTCTGATGGTGTT 56 270 bp
Ang-1 GCTTACCAGATTCACACTGTTCC TTGCTACCTTGCCAACAACAACTG 60 612 bp
IL-6 CACAGACAGCCACTCACCTC TTTTCTGCCAGTGCCTCTTT 60 137 bp
HGF ATGCATCCAAGGTCAAGGAG TTCCATGTTCTTGTCCCACA 61 349 bp