Skip to main content

Table 1 Primer sequences used in this study

From: The ability to suppress macrophage-mediated inflammation in orbital fat stem cells is controlled by miR-671-5p

Primers used in QPCR Sequence (5′ to 3′)
Human 18S-F ATGGCCGTTCTTAGTTGGTG
Human 18S-R AACGCCACTTGTCCCTCTAA
Human IDO-F CCCAAAGGAGTTTGCAGGGGGC
Human IDO-R GCCCAGCAGGACGTCAAAGCA
Human IL-1RA-F ACCTGCCCAACCTGCTCTCCT
Human IL-1RA-R GGAGCCACTTGGTTGGGGGTCA
Human IL-10-F TGTTGAGCTGTTTTCCCTGA
Human IL-10-R TTGTAGCAGTTAGGAAGCCC
Human sTNFR-II-F CCAGTCTTGTGTCTGCGTCT
Human sTNFR-II-R GAGGGGGAAGGCTGACTCTA
Human TGFβ-F GCAACAATTCCTGGCGATAC
Human TGFβ-R CTAAGGCGAAAGCCCTCAAT
Mouse GAPDH-F CCCCAGCAAGGACACTGAGCAAG
Mouse GAPDH-R GGGGTCTGGGATGGAAATTGTGAGG
Mouse IFNγ-F AACCCACAGGTCCAGCGCCA
Mouse IFNγ-R CACCCCGAATCAGCAGCGACT
Mouse TNFα-F CAACGCCCTCCTGGCCAACG
Mouse TNFα-R TCGGGGCAGCCTTGTCCCTT
Mouse IL-1α-F AGCTTGACGGCACCCTCGCA
Mouse IL-1α-R CGGAGAGCTTCGTGGCTGTGGA
Mouse IL-1β-F AACCGGCGCTGGAACTG
Mouse IL-1β-R GGTCCCTTGTGTCACCACCTT
  1. F, forward; IFNγ, interferon gamma; IDO, indoleamine 2,3-dioxygenase; IL, interleukin; IL-1RA, interleukin-1 receptor antagonist; QPCR, quantitative polymerase chain reaction; R, reverse; sTNFR, soluble tumor necrosis factor receptor; TGFβ, transforming growth factor beta; TNFα, tumor necrosis factor alpha.