Skip to main content

Table 1 Primers for quantitative real-time polymerase chain reaction

From: microRNA-378 promotes mesenchymal stem cell survival and vascularization under hypoxic–ischemic conditions in vitro

Gene name Forward primer (5′ to 3′) Reverse primer (5′ to 3′)
PDGFβ GCCAGCTAGCAGGGAATACT GGAGTTCATGTCTTCCACGAT
TNFα TGAAGTAGTGGCCTGGATTGC GACATTCCGGGATCCAGTGA
TUSC-2 ATGCCTGGTTCCTAGTTACTTG AACGGCTGAAATGCTCTGA
VEGFα AGATTCTGCAAGAGCACC AAGGTCCTCCTGAGCTAT
TGFβ1 TGCTTCAGCTCCACAGAGAA TGGTTGTAGAGGGCAAGGAC
BCL2 ATCCAGGATAACGGAGGCTG CAGGTATGCACCCAGAGTGA
BAX GGCGAATTGGAGATGAACTG TGCCATCAGCAAACATGTCA
β-actin AGGGAAATCGTGCGTGACAT GAACCGCTCATTGCCGATAG
  1. PDGF, platelet-derived growth factor; TGF, transforming growth factor; TNF, tumor necrosis factor; VEGF, vascular endothelial growth factor.