Skip to main content

Table 1 Primers used in RT-PCR and production sizes

From: Bone morphogenetic protein 2 gene transduction enhances the osteogenic potential of human urine-derived stem cells

  Amplication Ann.temp
Gene Primer sequence (5′-3′) Size (°C)
BMP2 Forward GAGAAGGAGGAGGCAAAGAAA 161 56
  Reverse AGCAGCAACGCTAGAAGACAG   
OCN Forward CCCCCTCTAGCCTAGGACC 151 56.4
  Reverse ACCAGGTAATGCCAGTTTGC   
Runx2 Forward CCAACCCACGAATGCACTATC 71 58.9
  Reverse TAGTGAGTGGTGGCGGACATAC   
GAPDH Forward ATCCCATCACCATCTTCC 293 51
  Reverse GAGTCCTTCCACGATACCA