Skip to main content

Table 1 Primers used for quantitative reverse-transcriptase polymerase chain reaction

From: Exosomes secreted by human-induced pluripotent stem cell-derived mesenchymal stem cells attenuate limb ischemia by promoting angiogenesis in mice

Genes Forward primer (5′-3′) Reverse primer (5′-3′)
h-Nanog TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG
h-Oct4 CCTCACTTCACTGCACTGTA CAGGTTTTCTTTCCCTAGCT
h-Msx1 CGAGAGGACCCCGTGGATGCAGAG GGCGGCCATCTTCAGCTTCTCCAG
h-VEGFA CGCTCGGTGCTGGAATTTGA AGTGGGGAATGGCAAGCAAA
h-VEGFB TGGAAGAGGAGACTGGGAGG TAGTGAGGGGAGGAAGAGCC
h-HIF-1α CCATGTGACCATGAGGAAAT CGGCTAGTTAGGGTACACTT
h-PGF AGATGAAGCCGGAAAGGTGC TAAATACACGAGCCGGGTGC
h-bFGF CAATTCCCATGTGCTGTGAC ACCTTGACCTCTCAGCCTCA
h-TGFB1 TTGAGGGCTTTCGCCTTAGC TGAACCCTGCGTTGATGTCC
h-Angiogenin CTCGCTTCGGCAGCACA GGTGGTCGGAGATTCGTAGC
h-KDR GTGATCGGAAATGACACTGGAG CATGTTGGTCACTAACAGAAGCA
h-bFGFR GACGGCTCCTACCTCAA GCTGTAGCCCATGGTGTTG
h-GAPDH ATCCCATCACCATCTTCC GAGTCCTTCCACGATACCA