Skip to main content

Table 2 RT-PCR Primers

From: Switching of mesodermal and endodermal properties in hTERT-modified and expanded fetal human pancreatic progenitor cells

Gene Primer sequences (5'-3'): Forward and Reverse Tm (°C) Product (basepairs) References
Insulin GCTGCATCAGAAGAGGCCATCAGGC
GCGTCTAGTTGCAGTAGTTCTCCAG
58 380 [11]
Glucagon GAATTCATTGCTTGGCTGGTGAAAGGC
CATTTCAAACATCCCACGTGGCATGCA
60 255 [11]
Pancreatic Polypeptide CTGCTGCTGCTGTCCACCTGCGTG
CTCCGAGAAGGCCAGCGTGTCCTC
60 206 [11]
Somatostatin CGTCAGTTTCTGCAGAAGTCCCTGGCT
CCATAGCCGGGTTTGAGTTAGCAGATC
60 206 [11]
NeuroD ATCCCAACCCACCACCAACC
CAGCGGTGCCTGAGAAGATT
60 440 [15]
Pancreatic duodenal homeobox1 gene (Pdx1) CTGCCTTTCCCATGGATGAA
CGCTTCTTGTCCTCCTCCTTT
58 277 [15]
Prohormone convertase (PC1/3) TTGGCTGAAAGAGAACGGGATACATCT
ACTTCTTTGGTCATTGCTTTGGCGGTG
65 456 [11]
Prohormone convertase (PC2) GCATCAAGCACAGACCTACACTGG
GAGACACAAACCACCCTTCATCCTTC
60 308 [11]
Chromogranin-A CGGACAGTTCCATGAAGCTCTC
GAGTCAGGAGTAGGAGACAAGG
58 444 [11]
Glucokinase GACGAGTTCCTGCTGGAGTATGAC
GACTCGATGAAGGTGATCTCGCAGCTG
65 523 [11]
Paired homeobox gene4 (PAX4) CACCTCTCTGCCTGAGGACACGGTGAG
CTGCCTCATTCCAAGCCATACAGTAGTG
64 443 [11]
Paired homeobox gene 6 (PAX6) CAGTCACAGCGGAGTGAATCAGC
GCCATCTTGCGTAGGTTGCCCTG
58 519 [11]
Glucose transporter2 (GLUT2) GCCATCCTTCAGTCTCTGCTACTC
GCTATCATGCTCACATAACTCATCCA
65 523 [11]
Betacellulin2 (BETA2) CCTGAGCAGAACCAGGACATGCC
ATCAAAGGAAGGGCTGGTGCAATCA
58 221 [11]
Neurogenin3 (NGN3) ACTGAGCAAGCAGCGACGGAGTC
GCACCCACAGCCGAGCGACAGAC
65 448 [11]
NK homeobox protein 6.1 (NKX6 1) CTCCTCCTCGTCCTCGTCGTCGTC
CTTGACCTGACTCTCTGTCATC
60 699 [11]
NK homeobox protein 2.2 (NKX2 2) CGGACAATGACAAGGAGACCCCG
CGCTCACCAAGTCCACTGCTGCTGG
65 490 [11]
Islet1 (ISL1) GTGCGGAGTGTAATCAGTATTTGG
GTCATCTCTACCAGTTGCTCCTTC
58 519 [11]
GATA2 transcription factor CGTCTTCTTCAATCACCTCG
CGTCTTGGAGAAGGGGCTC
55 225 [10]
GATA6 transcription factor GAAGAAGCACATGATTTTGGAC
GATGGAAGGGAAGGGCCAG
58 181 [10]
Transforming growth factor alpha (TGFα) ATGGTCCCCTCGGCTGGA
GGCCTGCTTCTTCTGGCTGGCA
58 297 [10]
Transforming growth factor beta1 (TGFβ1) GCCCTGGACACCAACTATTGCT
AGGCTCCAAATGTAGGGGCAGG
58 161 [10]
Transforming growth factor beta2 (TGFβ2) GATTTCCATCTACAAGACCACGAGGGACTTGC
CAGCATCAGTTACATCGAAGGAGAGCCATTCG
65 503 [10]
Transforming growth factor beta1 receptor (TGFβ1R) CGTGCTGACATCTATGCAAT
AGCTGCTCCATTGGCATAC
54 251 [10]
Transforming growth factor beta2 receptor (TGFβ2R) TGCACATCGTCCTGTGGAC
GTCTCAAACTGCTCTGAAGTGTTC
58 784 [10]
Insulin-like growth factor receptor (IGFR) ACCCGGAGTACTTCAGCGCT
CACAGAAGCTTCGTTGAGAA
55 229 [10]
Cytokeratin-19 ATGGCCGAGCAGAACCGGAA
CCATGAGCCGCTGGTACTCC
60 308 [16]
α-Smooth muscle actin AGTACCCGATAGAACATGG
TTTTCTCCCGGTTGGC
60 153 [9]
Vimentin CACCTACAGCCTCTACG
AGCGGTCATTCAGCTC
60 170 [9]
Human telomerase reverse transcriptase (hTERT) AAGTTCCTGCACTGGCTGATGAG
TCGTAGTTGAGCACGCTGAACAG
60 378 [17]
β-actin AGAGCTATGAGCTGCCTGAC
CTGATCCACATCTGCTGGAA
55 361 [15]
Glyceraldehyde phosphate dehydrogenase (GAPDH) CCATGGAGAAGGCTGGGG
CAAAGTTGTCATGGATGACC
58 194 [10]