Skip to main content

Advertisement

Table 2 RT-PCR Primers

From: Switching of mesodermal and endodermal properties in hTERT-modified and expanded fetal human pancreatic progenitor cells

Gene Primer sequences (5'-3'): Forward and Reverse Tm (°C) Product (basepairs) References
Insulin GCTGCATCAGAAGAGGCCATCAGGC GCGTCTAGTTGCAGTAGTTCTCCAG 58 380 [11]
Glucagon GAATTCATTGCTTGGCTGGTGAAAGGC CATTTCAAACATCCCACGTGGCATGCA 60 255 [11]
Pancreatic Polypeptide CTGCTGCTGCTGTCCACCTGCGTG CTCCGAGAAGGCCAGCGTGTCCTC 60 206 [11]
Somatostatin CGTCAGTTTCTGCAGAAGTCCCTGGCT CCATAGCCGGGTTTGAGTTAGCAGATC 60 206 [11]
NeuroD ATCCCAACCCACCACCAACC CAGCGGTGCCTGAGAAGATT 60 440 [15]
Pancreatic duodenal homeobox1 gene (Pdx1) CTGCCTTTCCCATGGATGAA CGCTTCTTGTCCTCCTCCTTT 58 277 [15]
Prohormone convertase (PC1/3) TTGGCTGAAAGAGAACGGGATACATCT ACTTCTTTGGTCATTGCTTTGGCGGTG 65 456 [11]
Prohormone convertase (PC2) GCATCAAGCACAGACCTACACTGG GAGACACAAACCACCCTTCATCCTTC 60 308 [11]
Chromogranin-A CGGACAGTTCCATGAAGCTCTC GAGTCAGGAGTAGGAGACAAGG 58 444 [11]
Glucokinase GACGAGTTCCTGCTGGAGTATGAC GACTCGATGAAGGTGATCTCGCAGCTG 65 523 [11]
Paired homeobox gene4 (PAX4) CACCTCTCTGCCTGAGGACACGGTGAG CTGCCTCATTCCAAGCCATACAGTAGTG 64 443 [11]
Paired homeobox gene 6 (PAX6) CAGTCACAGCGGAGTGAATCAGC GCCATCTTGCGTAGGTTGCCCTG 58 519 [11]
Glucose transporter2 (GLUT2) GCCATCCTTCAGTCTCTGCTACTC GCTATCATGCTCACATAACTCATCCA 65 523 [11]
Betacellulin2 (BETA2) CCTGAGCAGAACCAGGACATGCC ATCAAAGGAAGGGCTGGTGCAATCA 58 221 [11]
Neurogenin3 (NGN3) ACTGAGCAAGCAGCGACGGAGTC GCACCCACAGCCGAGCGACAGAC 65 448 [11]
NK homeobox protein 6.1 (NKX6 1) CTCCTCCTCGTCCTCGTCGTCGTC CTTGACCTGACTCTCTGTCATC 60 699 [11]
NK homeobox protein 2.2 (NKX2 2) CGGACAATGACAAGGAGACCCCG CGCTCACCAAGTCCACTGCTGCTGG 65 490 [11]
Islet1 (ISL1) GTGCGGAGTGTAATCAGTATTTGG GTCATCTCTACCAGTTGCTCCTTC 58 519 [11]
GATA2 transcription factor CGTCTTCTTCAATCACCTCG CGTCTTGGAGAAGGGGCTC 55 225 [10]
GATA6 transcription factor GAAGAAGCACATGATTTTGGAC GATGGAAGGGAAGGGCCAG 58 181 [10]
Transforming growth factor alpha (TGFα) ATGGTCCCCTCGGCTGGA GGCCTGCTTCTTCTGGCTGGCA 58 297 [10]
Transforming growth factor beta1 (TGFβ1) GCCCTGGACACCAACTATTGCT AGGCTCCAAATGTAGGGGCAGG 58 161 [10]
Transforming growth factor beta2 (TGFβ2) GATTTCCATCTACAAGACCACGAGGGACTTGC CAGCATCAGTTACATCGAAGGAGAGCCATTCG 65 503 [10]
Transforming growth factor beta1 receptor (TGFβ1R) CGTGCTGACATCTATGCAAT AGCTGCTCCATTGGCATAC 54 251 [10]
Transforming growth factor beta2 receptor (TGFβ2R) TGCACATCGTCCTGTGGAC GTCTCAAACTGCTCTGAAGTGTTC 58 784 [10]
Insulin-like growth factor receptor (IGFR) ACCCGGAGTACTTCAGCGCT CACAGAAGCTTCGTTGAGAA 55 229 [10]
Cytokeratin-19 ATGGCCGAGCAGAACCGGAA CCATGAGCCGCTGGTACTCC 60 308 [16]
α-Smooth muscle actin AGTACCCGATAGAACATGG TTTTCTCCCGGTTGGC 60 153 [9]
Vimentin CACCTACAGCCTCTACG AGCGGTCATTCAGCTC 60 170 [9]
Human telomerase reverse transcriptase (hTERT) AAGTTCCTGCACTGGCTGATGAG TCGTAGTTGAGCACGCTGAACAG 60 378 [17]
β-actin AGAGCTATGAGCTGCCTGAC CTGATCCACATCTGCTGGAA 55 361 [15]
Glyceraldehyde phosphate dehydrogenase (GAPDH) CCATGGAGAAGGCTGGGG CAAAGTTGTCATGGATGACC 58 194 [10]