Skip to main content

Table 2 Primer sequences and PCR conditions

From: Characterization of bursa subacromialis-derived mesenchymal stem cells

Gene Oligonucleotide primer sequence Number of cycles Annealing temp. (° C) Product size (bp)
Verfication of array data
PRG4 S: 5′—GCTTGCACCCACCACCACCA—3′ 38 60 210
A: 5′—AGCTCCTTGGGGGCAGGCTT—3′
FGF18 S: 5′—GTGGGGAAGCCCGATGGCAC—3′ 35 62 208
A: 5′—GAAGCTCCGGCTGCCCCTTG—3′
FGF9 S: 5′—AATGTGCCCGTGTTGCCGGT—3′ 35 60 421
A: 5′—GCCTTCCAGTGTCCACGTGCT—3′
Meox S: 5′—CCAACTGGCACCTCCCGCAG—3′ 37 62 204
A: 5′—CCGCAGGTGACAGTGCCTGG—3′
WISP3 S: 5′—CTGTGTTACATTCAGCCTTGCGAC—3′ 29 54 337
A: 5′—CTTGGTTTTACAGAATCTTGAGCTC—3′
CD200 S: 5′—TGGCAGCAGTGGTGCTGTGC—3′ 40 60 354
A: 5′— AGACGGTGAGGCAGGCCGTT—3′
BSP S: 5′—AATGAAAACGAAGAAAGCGAAG—3′ 33 54 450
A: 5′—ATCATAGCCATCGTAGCCTTGT—3′
FOXP2 S: 5′—AATCGCTGCCTCAAGCTGGC—3′ 30 61 493
A: 5′—GGTTTGGGCTCTGAGGGTCGC—3′
MUC1 S: 5′— AATGAATGGCTCAAAACTTGG —3′ 30 60 231
A: 5′— CACTAGGTTCTCACTCGCTCAG —3′
Differentiation assays
Chondrogenic marker genes
AGN S: 5′—TGAGGAGGGCTGGAACAAGTACC—3′ 30 54 392
A: 5′—GGAGGTGGTAATTGCAGGGAACA—3′
DEC S: 5′—AATTGAAAATGGGGCTTTCC—3′ 27 53 220
A: 5′—GCCATTGTCAACAGCAGAGA—3′
FM S: 5′—CTTACCCCTATGGGGTGGAT—3′ 35 54 389
A: 5′—GTACATGGCCGTGAGGAAGT—3′
SOX9 S: 5′—ATCTGAAGAAGGAGAGCGAG—3′ 35 58 263
A: 5′—TCAGAAGTCTCCAGAGCTTG—3′
IHH S: 5′—GAGGAGTCCCTGCATTATGA—3′ 30 54 321
A: 5′—CAGGAAAATGAGCACATCGC—3′
COL II S: 5′—TTTCCCAGGTCAAGATGGTC—3′ 35 58 374
A: 5′—CTTCAGCACCTGTCCACCA—3′
Osteogenic marker genes
ALP S: 5′—TGGAGCTTCAGAAGCTCAACACCA—3′ 25 51 454
A: 5′—ATCTCGTTGTCTGAGTACCAGTCC—3′
COL I S: 5′—GGACACAATGGATTGCAAGG—3′ 30 54 461
A: 5′—TAACCACTGCTCCACTCTGG—3′
Cbfa1 S: 5′—ACAGATGATGACACTGCCACC—3′ 30 55 324
A: 5′—CATAGTAGAGATATGGAGTGCTGC—3′
Adipogenic marker genes
LPL S: 5′—GAGATTTCTCTGTATGGCACC—3′ 30 51 276
A: 5′—CTGCAAATGAGACACTTTCTC—3′
PPARγ2 S: 5′—GCTGTTATGGGTGAAACTCTG—3′ 30 51 351
A: 5′—ATAAGGTGGAGATGCAGGCTC—3′
Internal control
EF1α S: 5′—AGGTGATTATCCTGAACCATCC-—3′ 24 54 234
A: 5′—AAAGGTGGATAGTCTGAGAAGC—3′
  1. A antisense, AGN aggrecan, ALP alkaline phosphatase, bp base pair, BSP integrin-binding sialoprotein, Cbfa1 core binding factor alpha 1, CD200 cluster of differentiation 200, COL I collagen type I, COL II collagen type II, DEC decorin, EF1α elongation factor 1α, FGF fibroblast growth factor, FM fibromodulin, FOXP2 forkhead box P2, IHH indian hedgehog, LPL lipoprotein lipase, Meox mesenchyme homeobox 2, MUC1 mucin 1, PPARγ2 peroxisome proliferator-activated receptor gamma 2, PRG4 proteoglycan 4, S sense, SOX9 SRY (sex determining region Y)-box 9, temp. temperature, WISP3 WNT1 inducible signalling pathway protein 3