Skip to main content

Table 1 mRNA primer information

From: Differential TLR activation of murine mesenchymal stem cells generates distinct immunomodulatory effects in EAE

Gene name Forward primer (5ʹ a 3′) Reverse primer (5′ a 3′) Access Number Gene Bank
TLR3 AAAACTCAGCGGCCAGGAAT AGTTACGAAGAGGGCGGAAA NM_126166.4
TLR4 TGGCTGGTTTACACGTCCAT GCAGAAACATTCGCCAAGCA NM_021297.2
18s ATCGCCAGTCGGCATCGTTTAT GCCGCTAGAGGTGAAATTCTTGGA NR_003286.2
  1. Abbreviations: TLR3, toll like receptor 3; TLR4, toll like receptor 4; 18S, 18S ribosomal RNA