Skip to main content

Advertisement

Table 1 Primers of three germ layer genes and the reference gene for quantitative real-time PCR

From: Preclinical study of mouse pluripotent parthenogenetic embryonic stem cell derivatives for the construction of tissue-engineered skin equivalent

Gene Primers (5′–3′) Product (bp)
Snai1 GACCTGTGGAAAGGCCTTCTCTAGG 170
CCTGGCACTGGTATCTCTTCACATC
Hand1 GCTACGCACATCATCACCATCATC 125
CAGCAGCCAGCTCTGGAAGTAAG
Gata2 GCCAAAAGAGAGACTGGAGGAAGGG 82
ACACCTCCCACCTTTTAGTCACTCTG
nestin GTTACCAAAGCCTCTTAGAAATGACC 577
CAGATGCAACTCTGCCTTATCCTC
Oct3/4 GTGTGAGGTGGAGTCTGGAG 182
AGCCTCATACTCTTCTCGTTGG
Afp CTCTGGCGATGGGTGTTTAG 175
TGCCTGGAGGTTTCGGGATT
Gapdh GGTGAAGGTCGGTGTGAACG 152
CTCGCTCCTGGAAGATGGTG