Skip to main content

Table 2 Sequences of primers used in quantitative RT-PCR

From: Mesenchymal stem cells improve mouse non-heart-beating liver graft survival by inhibiting Kupffer cell apoptosis via TLR4-ERK1/2-Fas/FasL-caspase3 pathway regulation

Gene Sequences Length (base)
β-actin Forward: CATTGCTGACAGGATGCAGAAGG 23
Reverse: TGCTGGAAGGTGGACAGTGAGG 22
IL1α Forward: ACGGCTGAGTTTCAGTGAGACC 22
Reverse: CACTCTGGTAGGTGTAAGGTGC 22
IL1β Forward: TGGACCTTCCAGGATGAGGACA 22
Reverse: GTTCATCTCGGAGCCTGTAGTG 22
IL2 Forward: GCGGCATGTTCTGGATTTGACTC 23
Reverse: CCACCACAGTTGCTGACTCATC 22
IL4 Forward: ATCATCGGCATTTTGAACGAGGTC 24
Reverse: ACCTTGGAAGCCCTACAGACGA 22
IL6 Forward: TACCACTTCACAAGTCGGAGGC 22
Reverse: CTGCAAGTGCATCATCGTTGTTC 23
IL10 Forward: CGGGAAGACAATAACTGCACCC 22
Reverse: CGGTTAGCAGTATGTTGTCCAGC 23
TNFα Forward: GGTGCCTATGTCTCAGCCTCTT 22
Reverse: GCCATAGAACTGATGAGAGGGAG 23
IFNγ Forward: CAGCAACAGCAAGGCGAAAAAGG 23
Reverse: CAGCAACAGCAAGGCGAAAAAGG 23
F4/80 Forward: CGTGTTGTTGGTGGCACTGTGA 22
Reverse: CCACATCAGTGTTCCAGGAGAC 22
  1. IFN interferon, IL interleukin, RT-PCR real-time polymerase chain reaction, TNF tumour necrosis factor