Skip to main content

Table 2 List of primers used for qPCR

From: Extracellular matrix components and culture regimen selectively regulate cartilage formation by self-assembling human mesenchymal stem cells in vitro and in vivo

Gene Forward sequence Reverse sequence
ACAN CCCCTGCTATTTCATCGACCC GACACACGGCTCCACTTGAT
C4ST CATCTACTGCTACGTGCCCA CTTCAGGTAGCTGCCCACTC
C6ST CTCGGAGCAGTTCGAGAAGTG CGCCAGTTTGTAGCCGAAGA
CHM1 CTGGATCACGAAGGAATCTGT ACCATGCCCAAGATACGGG
COL10A1 CATAAAAGGCCCACTACCCAAC ACCTTGCTCTCCTCTTACTGC
COL1A1 GATCTGCGTCTGCGACAAC GGCAGTTCTTGGTCTCGTCA
COL2A1 AGACTTGCGTCTACCCCAATC GCAGGCGTAGGAAGGTCATC
GAPDH TGTTGCCATCAATGACCCCTT CTCCACGACGTACTCAGCG
MATN3 TCTCCCGGATAATCGACACTC CAAGGGTGTGATTCGACCCA
RUNX2 CCGTCTTCACAAATCCTCCCC CCCGAGGTCCATCTACTGTAAC
SOX9 AGCGAACGCACATCAAGAC CTGTAGGCGATCTGTTGGGG