Skip to main content

Table 1 PCR primers

From: Distribution pattern following systemic mesenchymal stem cell injection depends on the age of the recipient and neuronal health

Name Gene Sense primer (5'–3') Antisense primer (5'–3') NCBI accession number
36B4 Ribosomal protein large P0, RPLP0 CCGTGTGAGGTCACTGTGCCAGCTC GCCCAAAGCCTGGAAGAAGGAGGTC NM_007475.5
MCP-1 Transcription regulatory protein MCP-1 (POU 1) GCAGTAATCCTCACCAGCCCAACGC GATCCCGTCCTCATCCAGACTTGG L13763.1