Skip to main content

Table 1 Primer list

From: Exosomes from mesenchymal stem cells induce the conversion of hepatocytes into progenitor oval cells

Target Sequence
Alpha fetoprotein Forward: CACACCCGCTTCCCTCAT
Reverse: CAAACTCATTTTCGTGCAATGC
Cytokeratin 19 Forward: GACCTGCGTCCCTTTTTCCT
Reverse: CTGAGGTCTGGCGATAGCTATAGG
γ-glutamyltranspeptidase (GGT) Forward: TCACAGCCCAGATTGTGAAA
Reverse: TCAGCTCAGCACGGTAGTTG
Thy1 Forward: ATCCCCCAGACAGCGAGAGT
Reverse: CGCCTGCCCCTGAGATT
CD34 Forward: GGGTAGCTCTCTGCCTGATG
Reverse: TCCGTGGTAGCAGAAGTCAA
Lgr5 Forward: GACTTTAACTGGAGCAAAGATCTC
Reverse: CGAGTAGGTTGTAAGACAAATCTA
DLK1 Forward: GTAGCAAAAGCGGGAAAGC
Reverse: GGGTCCTAACTTCAGCCACA
Onecut 2 (OC2) Forward: CCGAGTTCCAGCGCATGT
Reverse: TCTTTGTTTGGTTCTTGCTCTTTG
EpCAM Forward: CGGTTTGACTTGGTATCCCTTT
Reverse: CCGGAAGGACCGGATGTC