Skip to main content

Table 1 Quantitative real-time PCR primers

From: Exosomes as potential alternatives to stem cell therapy for intervertebral disc degeneration: in-vitro study on exosomes in interaction of nucleus pulposus cells and bone marrow mesenchymal stem cells

Gene Primer Sequence (5′–3′)
ACAN Forward ACCAGACTGTCAGATACCCC
Reverse CATAAAAGACCTCACCCTCC
SOX-9 Forward GCCTCTACTCCACCTTCACC
Reverse GTAGACGGGTTGTTCCCAGT
COL2A1 Forward ATTGCCTATCTGGACGAAGC
Reverse GCAGTGTACGTGAACCTGCT
CA12 Forward CGTGCTCCTGCTGGTGATCT
Reverse AGTCCACTTGGAACCGTTCACT
KRT19 Forward AAGACACACTGGCAGAAACG
Reverse GATTCTGCCGCTCACTATCA
HIF-1α Forward GCCAGACGATCATGCAGCTA
Reverse ATCCATTGATTGCCCCAGCA
MMP-1 Forward GGAACAGATACGAAGAGGAAACA
Reverse TGTGGGAATCAGAGGTAGAAGA
MMP-3 Forward GCATTGGCTGAGTGAAAGAGAC
Reverse ATGATGAACGATGGACAGATGA
TIMP-1 Forward GGTTCCCTGGCATAATCTGAG
Reverse ATCGCTCTGGTAGCCCTTCT
β-ACTIN Forward GTGGGGCGCCCCAGGCACCA
Reverse CTTCCTTAATGTCACGCACGATTTC
  1. ACAN aggrecan, COL2A1 collagen II α1, SOX-9 SRY-related high mobility group-box gene 9, KRT19 cytokeratin-19, CA12 carbonic anhydrase XII, HIF-1α hypoxia-inducible factor 1α, MMP matrix metalloproteinase, TIMP-1 tissue inhibitor of metalloproteinases-1