Fig. 2

A549-derived exosome miR-371b-5p promotes ATIIC-specific proliferation. a Histogram representation of the number of viable cells in the cultures of hiPSC-ATIICs, hATIICs, mATIICs, human NK cells, and human monocytes after being treated with ATIIC-phenotype-specific Exo-miRs. b ATIIC-phenotype-specific Exo-miR expression patterns were represented by color heat maps (A: A549 cells, B: hiPSC-ATIICs). Nine Exo-miRs showed significantly differential expression between A549 cells and hiPSC-ATIICs (marked with * or #), eight of which (marked with *) showed significantly elevated expression in A549 cells. c Schematic structure of miRNA-inhibitor vectors. Each vector harbors a miRNA targeting motif corresponding to one of the eight selected miRNA sequences. The targeting motif in the vector is separated from its inverted repeat sequence by a spacer of 8 nt. The diagram is drawn to show relevant information only, not scaled proportionally according to the sequence length. The sequences of targeting motifs used to build the miRNA-inhibitor vectors are listed below: (1) aaagtgccgccatcttttgagt for miR-371b-5p, (2) gcacagcccccgtccctccct for miR-149, (3) cgccgccccgcacctgct for miR-3665, (4) cagagcccgccccaacccac for miR-3940-5p, (5) cccccgcctccgccgccgcc for miR-3960, (6) gcctgccccctccaacagcca for miR-4687-3p, (7) gcggtcccgcggcgccccgcct for miR-663, and (8) gctcggccccggccccagcccc for miR-762. d The content of SPC-expressing cells (top panel) and the relative SPC expression levels (QRT-PCR, bottom panel) in the differentiated cultures of pluripotent stem cells were analyzed to show the effects of A549-derived Exo-miRs on ATIIC-specific differentiation (day 12) and proliferation (day 16) after one of the A549-specific Exo-miRs had been inhibited. ATIICs alveolar epithelial type II cells, DM differentiation medium, Exo-miRs exosome miRNAs, hATIICs human primary ATIICs, hESCs human embryonic stem cells, hiPSC-ATIICs human induced pluripotent stem cell-derived ATIICs, hmonos human peripheral blood monocytes, mATIICs mouse primary ATIICs, SPC surfactant protein C