Skip to main content

Table 1 Primers used for real-time quantitative reverse transcription-polymerase chain reaction

From: Cell sex affects extracellular matrix protein expression and proliferation of smooth muscle progenitor cells derived from human pluripotent stem cells

Gene Strand 5′–3′ sequence Accession number
GAPDH Sense CTCAACGACCACTTTGTCAAGCTCA NC_000012.12
Anti-sense GGTCTTACTCCTTGGAGGCCATGTG
Hu-SMA-alpha Sense CCAGTGTGGAGCAGCCCAGC NC_000001.11
Anti-sense TCACCCCCTGATGTCTGGGACG
Hu-Smoothelin Sense TTGGACAAGATGCTGGATCA NC_000022.11
Anti-sense CGCTGGTCTCTCTTCCTTTG
SM22-alpha Sense GCTTGGAGCCATCAGGGTA NC_000011.10
Anti-sense GGAGTGGATCATAGTGCAGTGT
Collagen I-alpha1 Sense TGTCTTATGGCTATGATGAG NC_000017.11
Anti-sense ATCCAAACCACTGAAACC
Collagen III-alpha1 Sense GGCTCCTGGTGAGCGAGGAC NC_000002.12
Anti-sense CCCATTTGCACCAGGTTCTCC
Hu-Elasin Sense GTCGCAGGTGTCCCTAGTGT NC_000007.14
Anti-sense GGTCCCCACTCCGTACTTG
TIMP-1 Sense GGGCTTCACCAAGACCTACA NC_000023.11
Anti-sense TGCAGGGGATGGATAAACAG
MMP-1 Sense AGTGACTGGGAAACCAGATGCTGA NC_000011.10
Anti-sense TCTGCTTGACCCTCAGAGACC
MMP-2 Sense CGAATCCATGATGGAGAGGC NC_000016.10
Anti-sense TCCGTCCTTACCGTCAAAGG
  1. GenBank accession numbers indicate transcript variants with homologous sequences to primers