Skip to main content

Table 1 Primers used for RT-PCR

From: Antimicrobial peptides secreted by equine mesenchymal stromal cells inhibit the growth of bacteria commonly found in skin wounds

Gene product Abbreviation Forward primer (5′-3′) Reverse primer (5′-3′)
Cystatin C CST3 TTTCCTGTCACCGTACAGC GCACAATGTCCGTGGTGAA
Elafin PI3 GAGAAGGCTGAGTGCCAGAG ACCAGCGAAATCATCTCCAG
Lipocalin 2 LCN2 TCAAGGATGACCAGTTCCAG CCTTCCTGAAGAACACGATG
Cathelicidin CAMP GGGTAGATGGTCACTGTTGC AGCCCATTCTCCTTGAAGTC
Beta defensin 2 DEFB4A CGTTCCTCGTTGTCTTCCT CACAGGTGCCAATCTGTTTC
Beta-2-microglobulin B2M GGGCTACTCTCCCTGACTGG TACCTGCCCACACAGGTCAA