Skip to main content

Table 1 Quantitative polymerase chain reaction primer sequences

From: Effects of platelet-rich plasma on the activity of human menstrual blood-derived stromal cells in vitro

Name Sequence (5′-3′)
FoxO1 F: TACGAGTGGATGGTCAAGAGC
R: TGAACTTGCTGTGTAGGGACA
HOXA10 F: CTGAGGTCAATGGTGCAAAGGA
R: TTTGCCAACCTGCATGTCCA
LIF F: CCAACAGCAAGACGAGGATG
R: GATGAAGCAGGAAGGAGAAGG
CK18 F: ATCTTGGTGATGCCTTGGAC
R: CTCAGAACTTTGGTGTCATTGG
IL-1β F: TGGCAATGAGGATGACTTGT
R: TGGTGGTCGGAGATTCGTA
IL-6 F: TTCGGTCCAGTTGCCTTCT
R: GGTGAGTGGCTGTCTGTGTG
RUNX2 F: GCAGCAGCAGCAGCAGGAG
R: GCACCGAGCACAGGAAGTTGG
PPARγ2 F: AGAACAGATCCAGTGGTTGCAGATTAC
R: CAGACACGACATTCAATTGCCATGAG
GAPDH F: CAGGAGGCATTGCTGATGAT
R: GAAGGCTGGGGCTCATTT