Skip to main content

Advertisement

Table 3 Taqman® primers and probes used in gene expression analysis

From: Inflammatory licensed equine MSCs are chondroprotective and exhibit enhanced immunomodulation in an inflammatory environment

Gene Abbreviation Function Forward 5′–3’ Reverse 5′–3’ Probe
18S ribosomal RNA 18S Ribosome structural unit GGCGTCCCCCAACTTCTT AGGGCATCACAGACCTGTTATTG TGGCGTTCAGCCACCCGAGATT
Collagenase 3 MMP-13 Matrix metalloproteinase TGAAGACCCGAACCCTAAACAT GAAGACTGGTGATGGCATCAAG CAAAACACCAGACAAATGCGATCCTTCCTTA
Aggrecan ACAN Cartilage extracellular matrix GATGCCACTGCCACAAAACA GGGTTTCACTGTGAGGATCACA CCGAGGGTGAAGCTCGAGGCAA