Skip to main content

Table 1 Sequence-specific primers

From: Conditioned medium from bone marrow-derived mesenchymal stem cells inhibits vascular calcification through blockade of the BMP2–Smad1/5/8 signaling pathway

Gene Sequence (5′–3′)
BMP2 Forward TCTTCCGGGAACAGATACAGG
Reverse TGGTGTCCAATAGTCTGGTCA
BMPR1A Forward GGCCATTGCTTTGCCATTATAG
Reverse CTTTCGGTGAATCCTTGCATTG
BMPR1B Forward CCGACCTCGGTACAGCATTG
Reverse GCTCTGAGACTGCTCGATCAAG
BMPR2 Forward TTGGGATAGGTGAGAGTCGAAT
Reverse TGTTTCACAAGATTGATGTCCCC
Msx2 Forward GGAGCACCGTGGATACAGG
Reverse TAGAAGCTGGGATGTGGTGAA
Runx2 Forward ATGCTTCATTCGCCTCACAAA
Reverse GCACTCACTGACTCGGTTGG
osteocalcin Forward TGTCTTCTCCACAGCCTTCATG
Reverse ACCACTCCAGCACAACTCCTTC
GAPDH Forward ACCACAGTCCATGCCATCAC
Reverse TCCACCACCCTGTTGCTGTA