Skip to main content

Table 1 Primer sequences for quantitative real-time PCR

From: RETRACTED ARTICLE: Endothelial progenitor cell-derived exosomes, loaded with miR-126, promoted deep vein thrombosis resolution and recanalization

Gene name Forward primer (5′-3′) Reverse primer (5′-3′)
GAPDH TGTGTCCGTCGTGGATCTGA ACCACCTTCTTGATGTCATCATACTT
Pcdh7 ATGCTGAGGATGCGGACCA CTACAGATAAACTTCTCTTCTAGTG