Skip to main content

Table 1 Sequences used in the dual luciferase reporter assay

From: The suppressive effects of miR-508-5p on the odontogenic differentiation of human dental pulp stem cells by targeting glycoprotein non-metastatic melanomal protein B

Name Sequence (5′-3′)
GPNMB-3′-UTR-Wt ……CAAGAATTTAAAGGAGTTTCTTAAATTTCGACCTTGTTTCTGAAGCTCACTTTTCAGTGCCATTGATGTGAGATGTGCTGGAGTGGCTATTAACCTTTTTTTCCTAAAGATTATTGTTAAATAGATATTGTGGTTTGGGGAAGTTGAATTTTTTATAGGTTAAAT……
GPNMB-3′-UTR-Mt ……CAAGAATTTAAAGGAGTTTCTTAAATTTCGACCTTGTTTCTGAAGCTCACTTTTCAGTGCCATTGATGTGAGATGTGCTCCTGTGGCTATTAACCTTTTTTTCCTAAAGATTATTGTTAAATAGATATTGTGGTTTGGGGAAGTTGAATTTTTTATAGGTTAAAT……
  1. The italicized letters indicate the different nucleotieds between GPNMB-3'-UTR-Wt and GPNMB-3'-UTR-Mut.