Skip to main content

Table 2 Primers for real-time RT-PCR

From: The suppressive effects of miR-508-5p on the odontogenic differentiation of human dental pulp stem cells by targeting glycoprotein non-metastatic melanomal protein B

Gene Accession Forward Reverse
GPNMB NM_001005340.1 AAGTGAAAGATGTGTACGTGGTAACAG TCGGATGAATTTCGATCGTTCT
ALP NM_000478.5 CTATCCTGGCTCCGTGCTC GCTGGCAGTGGTCAGATGTT
DSPP NM_014208.3 GGGACACAGGAAAAGCAGAA TGCTCCATTCCCACTAGGAC
DMP-1 NM_004407.3 GTGAGTGAGTCCAGGGGAGATAA TTTTGAGTGGGAGAGTGTGTGCC
OCN NM_001199662.1 CTCACACTCCTCGCCCTATT TTGGACACAAAGGCTGCAC
GAPDH NM_002046.3 GTTGTCTCCTGCGACTTCA GGTGGTCCAGGGTTTCTTA
miR-508-5p MI0003195 ACACTCCAGCTGGGTACTCCA GAGGGCGTCACT TGGTGTCGTGGAGTCG
U6 NR_004394 GCTTCGGCAGCACATATACTAAAAT CGCTTCACGAATTTGCGTGTCAT