Skip to main content

Advertisement

Table 1 Primer information in the qRT-PCR assay

From: Dermal mesenchymal stem cells: a resource of migration-associated function in psoriasis?

Target gene Primer sequence (5′-3′) Annealing temperature (°C) Product size (bp)
ACTB Sense AGAGCTACGAGCTGCCTGAC 60 270
Antisense AGCACTGTGTTGGCGTACAG
SFRP2 Sense ACGGCATCGAATACCAGAACA 58 176
Antisense CTCGTCTAGGTCATCGAGGCA
NETO2 Sense AGATGGGCCATTTGGTTTCTC 56 139
Antisense TGCTCGAAATCCCAGTCCTTC
SULF2 Sense CACTGGCAAGTACGTCCACAA 60 111
Antisense CTATTGAGGTACACGGCAAAGG
COL8A1 Sense GGGAGTGCTGCTTACCATTTC 56 75
Antisense AGCGGCTTGATCCCATAGTAG
NRK Sense CATTGGCCTTGGTACTTATGGC 59 93
Antisense GTCTTACGAGCGTTCATCACTT
SYTL2 Sense GCCCAGTGTAAGGACTTAGCA 60 87
Antisense GCCTTTGTCTGGTAGCAAATAGG
CMKLR1 Sense CAGTTACGGTGATGAATACCCTG 60 115
Antisense GACGATGCTGTAGACCACCAC
  1. bp base pair