Skip to main content

Advertisement

Table 2 Primer sequences for RT-qPCR

From: microRNA-301b-3p downregulation underlies a novel inhibitory role of long non-coding RNA MBNL1-AS1 in non-small cell lung cancer

Genes Primer sequences (5′-3′)
miR-301b-3p F: CAGGTGCTCTGACGAGGTTG
R: TGGTCCCAGATGCTTTGACA
U6 F: CTCGCTTCGGCAGCACATA
R: AACGATTCACGAATTTGCGT
lncRNA MBNL1-AS1 F: CTCCCGCTTCTTCTACCGAC
R: TTGGTGCATTTTAAGGCGGC
TGFBR2 F: GTAGCTCTGATGAGTGCAATGAC
R: CAGATATGGCAACTCCCAGTG
GAPDH F: GAAGGTGAAGGTCGGAGTC
R: GAAGATGGTGATGGGATTTC
  1. Note: RT-qPCR reverse transcription quantitative polymerase chain reaction, MBNL1-AS1 muscleblind-like 1-antisense RNA 1, miR-301b-3p, microRNA-301b-3p, GAPDH glyceraldehyde-3-phosphate dehydrogenase, lncRNA long non-coding RNA, TGFBR2 transforming growth factor beta receptor II, F forward, R reverse