Skip to main content

Table 1 Primers used for qRT-PCR

From: Differentiation of adipose-derived stem cells to functional CD105neg CD73low melanocyte precursors guided by defined culture condition

  Forward Reverse
MC1R TTGGACGCTTTCACGCTCTG TCTGGAAACTGAGTGAGCCCT
MITF-M CAGCGTGTATTTTTCCCACAG ATGTCTGGATCATTTGACTTGGG
MITF-T ACTTTAGCTTTCTGAGCAAGAGG CCAAGGAAGTCACAGGCATAAA
PAX3 TCCGAGACAAATTACTCAAGGAC TCACCTTTCCCGAATTTACTTCTC
PAX6 CCAGCAACACACCTAGTCATATTC GCCAGATGTGAAGGAGGAAAC
PMEL AACTCCAGAGGCTACAGGTATG GTCTCCACCCACTCTGTAGTT
SOX2 GGAGAGAGAAAGAAAGGGAGAGA GCCGCCGATGATTGTTATTATTAT
SOX10 ACTTTAGCTTTCTGAGCAAGAGG CCAAGGAAGTCACAGGCATAAA
TRP2 GTACGACAGAGACAAGGAAAGTAAG CCCAAGCAACTGAGCAGAAA
TYR GATTGTCTGTAGCCGATTGGAG GGGTTCTGGATTTGTCATGGT
IL-6 AAATTCGGTACATCCTCGACGGCA AGTGCCTCTTTGCTGCTTTCACAC
TGF-β1 TGGACTTCGGCCACATCAAGAAGA TGTTGTAAAGGGCCAGGACCTGAT
GAPDH CAGCCTCAAGATCATCAGCA CATGAGTCCTTCCACGATAC