Skip to main content

Table 1 Primers for qPCR

From: PBX homeobox 1 enhances hair follicle mesenchymal stem cell proliferation and reprogramming through activation of the AKT/glycogen synthase kinase signaling pathway and suppression of apoptosis

Gene Forward primers (5′ to 3′) Revers primers(5′ to 3′)
PBX1 GAGACGGAATTTCAACAAGCA GTTTGATACCTGGGAGACTG
Endo-OCT4 GGGAGGAGCTAGGGAAAGAAAACCT GAACTTCACCTTCCCTCCAACCAGT
Endo-SOX2 TTAGAGCTAGTCTCCAAGCGACGA CCACAGAGATGGTTCGCCAG
NANOG ATGGAGGGTGGAGTATGGTTGG AGGCTGAGGCAGGAGAATGG
CRIPTO TACCTGGCCTTCAGAGATGACA CCAGCATTTACACAGGGAACAC
FOXD3 AAGCCCAAGAACAGCCTAGTGA GGGTCCAGGGTCCAGTAGTTG
LIN28 CAGGTGCTACAACTGTGGAGG GCACCCTATTCCCACTTTCTCC
FGF4 CTACAACGCCTACGAGTCCTACA GTTGCACCAGAAAAGTCAGAGTTG
ESG1 ATATCCCGCCGTGGGTGAAAGTTC ACTCAGCCATGGACTGGAGCATCC
GAPDH CCATGTTCGTCATGGGTGTGA CATGGACTGTGGTCATGAGT