Skip to main content

Table 1 Primer sequences for real-time PCR

From: The enhanced effect and underlying mechanisms of mesenchymal stem cells with IL-33 overexpression on myocardial infarction

Gene names Forward primer sequences Reverse primer sequences
IL-33 TGACACACTGAGTATCCAAGG TATCTTTTTCTTGGTTTTTCC
IDO ATCTTGCCGTTCCCTACT CTGCGATTTCCACCATTA
COX2 CCTTCCTCCTGTGGCTGAT GGGCAAAGAATGCGAACA
T-bet AGCCGTTTCTACCCCGACCTT GCAGAGGGTAGGAGTGTGGGC
GATA-3 CTCCTCCTCTACGCTCCTTGC AAAAAAAAAGGAGGGAGAGA
FOXP3 CGAGCTTCCCAGAGAGAGAGT TGAGTTGTTGCCTGCCCCTCA
IL-6 CCTTCTTGGGACTGATGT ACTGGTCTGTTGTGGGTG
TNFα CCACGCTCTTCTGTCTACTG GCTACGGGCTTGTCACTC
IL-1β TGTGATGTTCCCATTAGAC AATACCACTTGTTGGCTTA
iNOS CGGTGCGGTCTTTTCCTATG GAGGGGAGATGATGTGAGGG
Arg-1 GACATCAACACTCCGCTGAC TTGCCAATTCCCAGCTTGTC
GAPDH TTC TTG TGC AGT GCC AGC CTC GTC TAG GAA CAC GGA AGG CCA TGC CAG