Skip to main content

Table 1 Primers for real-time PCR

From: Adipose mesenchymal stem cell transplantation alleviates spinal cord injury-induced neuroinflammation partly by suppressing the Jagged1/Notch pathway

Gene Sequence
IL-6 GAGTCCTTCAGAGAGATACAGAAAC
TGGTCTTGGTCCTTAGCCAC
IL-1β GAAATGCCACCTTTTGACAGTG
CTGGATGCTCTCATCAGGACA
TNF-α CCCTCACACTCAGATCATCTTCT
GCTACGACGTGGGCTACAG
β-actin ATCAACGACCCCTTCATTGACC
CCAGTAGACTCCACGACATACTCAG