Skip to main content

Table 1 Sequences of primers for the quantitative real-time polymerase chain reaction

From: Therapeutic effect of integrin-linked kinase gene-modified bone marrow-derived mesenchymal stem cells for streptozotocin-induced diabetic cystopathy in a rat model

Gene symbol Forward primer (5′-3′) Rcverse primer (5′-3′)
GSK-3β GACTAAGGTCTTCCGACCCC TTAGCATCTGACGCTGCTGT
CDH1 AGCTACCCCAGGACACCCAA GCAACGCAATCAGAGTCAACG
ILK TTTGCAGTGCTTCTGTGGGAA CTACTTGTCCTGCATCTTCTC
AKT ACTCATTCCAGACCCACGAC AGCCCGAAGTCCGTTATCTT
β-actin CCACCATGTACCCAGGCATT AGGGTGTAAAACGCAGCTCA