Skip to main content

Table 2 Sequences of PCR primers

From: Mitigative efficacy of the clinical dosage administration of granulocyte colony-stimulating factor and romiplostim in mice with severe acute radiation syndrome

Gene Primer sequence (5′ to 3′)
Ho-1 F: AGGGTCAGGTGTCCAGAGAA
R: CTTCCAGGGCCGTGTAGATA
Fth1 F: TGGAGTTGTATGCCTCCTACG
R: TGGAGAAAGTATTTGGCAAAGTT
Nqo1 F: AGCGTTCGGTATTACGATCC
R: AGTACAATCAGGGCTCTTCTCG
Gclc F: AGATGATAGAACACGGGAGGAG
R: TGATCCTAAAGCGATTGTTCTTC
Gclm F: TGACTCACAATGACCCGAAA
R: TCAATGTCAGGGATGCTTTCT
Gsr F: ACTATGACAACATCCCTACTGTGG
R: CCCATACTTATGAACAGCTTCGT
Txnrd1 F: TCTGAAGAAAAAGCCGTAGAGAA
R: TTCCAATGGCCAAAAGAAAC
ATP6 F: CCATAAATCTAAGTATAGCCATTCCAC
R: AGCTTTTTAGTTTGTGTCGGAAG
  1. F forward primer, R reverse primer