Skip to main content

Table 1 Primers used for qPCR for ovine genes

From: Characterisation of ovine bone marrow-derived stromal cells (oBMSC) and evaluation of chondrogenically induced micro-pellets for cartilage tissue repair in vivo

Gene Forward Reverse Amplicon (bp) Accession #
ACAN TTTGGACTTTGGCAGAATACC AATCCAGAAGGAAGACCACTTG 78 FJ200438.1
COL2A1 CTGTCCTTCGGTGTCACGG CGGGCTTCCACACATCCTTAT 93 XM_027967399.1
COL1A1 CAGGGAGACAGAGGCATCAAG ATCTTTGCCAGGAGTACCAGC 156 XM_027974706.1
COL10A1 GCATAAAAGGCCCACCATCC CTGGTGGACCGGGGATAC 88 XM_004011185.4
SOX9 CAAGCTCTGGAGACTGCTGAA CCGTTCTTCACCGACTTCCT 135 XM_027974011.1
RUNX2 CGCCTCACAAACAACCACAG GCTTGCAGCCTTAAATGACTCT 143 XM_027959124.1
GAPDH ACAGTCAAGGCAGAGAACGG CCAGCATCACCCCACTTGAT 98 NM_001190390.1