Skip to main content

Table 1 Primers sequences for qRT-PCR

From: Human umbilical cord mesenchymal stem cell-derived exosomal miR-27b attenuates subretinal fibrosis via suppressing epithelial–mesenchymal transition by targeting HOXC6

Primers Sequences (5′ to 3′)
has-miR-100-5p F′ AACCCGTAGATCCGAACTTGTG
has-miR-21-5p F′ GCAGTAGCTTATCAGACTGATG
has-miR-27b-3p F′ TTCACAGTGGCTAAGTTCTGC
has-miR-145-5p F′ GGTCCAGTTTTCCCAGGA
has-miR-23b-3p F′ AGATCACATTGCCAGGGA
has-miR-221-3p F′ CAGAGCTACATTGTCTGCTG
has-miR-204-5p F′ CAGTTCCCTTTGTCATCCTATG
has-miR-211-5p F′ GCAGTTCCCTTTGTCATCCT
  1. The 3′ primer for above Forward qPCR is the mRQ 3′ Primer, along with U6 Forward Primer and U6 Reverse Primer are supplied in Mir-X miRNA First-Strand Synthesis Kit (Cat. No. 638313)