Skip to main content

Table 1 Primer sequences for RT-qPCR

From: microRNA-27b shuttled by mesenchymal stem cell-derived exosomes prevents sepsis by targeting JMJD3 and downregulating NF-κB signaling pathway

Gene Sequences
miR-27b F: GGGGTTCACAGTGGCTAA
R: CAGTGCGTGTCGTGGAGT
U6 F: GCTTCGGCAGCACATATACTAAAAT
R: CGCTTCACGAATTTGCGTGTCAT
  1. Note: RT-qPCR reverse transcription quantitative polymerase chain reaction, miR-27b microRNA-27b, F forward, R reverse